View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5854-Insertion-8 (Length: 347)
Name: NF5854-Insertion-8
Description: NF5854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5854-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 7 - 347
Target Start/End: Original strand, 50460306 - 50460646
Alignment:
| Q |
7 |
cactttctaatggggatcaatttgaacagggtcactattgttgatattgagcttcgaattttcttcatagtcttggtcttttttaagatttcaacttcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50460306 |
cactttctaatggggatcaatttgaacagggtcactattgttgatattgagcttcgaattttcttcatagtcttggtcttttttaagatttcaacttcag |
50460405 |
T |
 |
| Q |
107 |
acaatctaccagcaaattttgtatttggagattctctagttgatgtaggaaacaataattacattatttctctctcaaaggctaattttttgcctaatgg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50460406 |
acaatctacctgcaaattttgtatttggagattctctagttgatgtaggaaacaataattacattatttctctctcaaaggctaattttttgcctaatgg |
50460505 |
T |
 |
| Q |
207 |
tatcgattttggaagaccaacagggagattcaccaatggaagaaccatagttgacatcattggtaagattttattagtaataaaattatttcccttattt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50460506 |
tatcgattttggaagaccaacagggagattcaccaatggaagaaccatagttgacatcattggtaagattttattagtaataaaattatttcccttattt |
50460605 |
T |
 |
| Q |
307 |
cattctacttgatagtcactatttttatataacgagtctta |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50460606 |
cattctacttgatagtcactatttttatataacgagtctta |
50460646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University