View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5855_high_12 (Length: 426)
Name: NF5855_high_12
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5855_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 40858988 - 40859315
Alignment:
| Q |
1 |
aaatcttgcatgatcacaggattaaatgtatacgcataaagagatacatttctctgaaatataagatcattctttttctttttactttagaaaaatgtct |
100 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
40858988 |
aaatcttgcatgatcacatgagtaaatgtatacgcataaagagatacatatctctgaaatataaaatcattctttttctttttactttagaaaaa-gtct |
40859086 |
T |
 |
| Q |
101 |
tttgcgtatgtacctagacactatgcattttgttttgtgaccatacaaaaattctctaacacttattcctaatatccttcaatgtgtatgaatgtcatca |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859087 |
tttgcgtatgtgcctagacactatgcattttgtttagtgaccatacaaaaattatgtaacgcttattcctaatatccttcaatgtgtatgaatgtcatca |
40859186 |
T |
 |
| Q |
201 |
acgctgtcgtggttcaacattgcatgcaaaatttaattttattcaaaatttgacaaaatgactaacaaacaaaggggaaattgg-------taaatatta |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40859187 |
acgctgtcgtggttcaacattgcatgcaaaatttaattttgttcaaaatttgacaaaatgactaacaaacaaaggggaaattggtaaatattaaatatta |
40859286 |
T |
 |
| Q |
294 |
ttatgttttgattggcaatgaaaaataag |
322 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40859287 |
ttatgttttgattggcaatgaaaaataag |
40859315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University