View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5855_high_18 (Length: 345)
Name: NF5855_high_18
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5855_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 26579125 - 26579453
Alignment:
| Q |
1 |
gtatgaattagagaatcctttgctacagaacaaacatctaggagccttaaagatccgtctaaaagctcgtcggtccatttctcttgacgtgcgtggacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26579125 |
gtatgaattagagaatcctttgctacagaacaaacatctaggagccttaaagatccgtctaaaagctcgtcggtccatttctcttgacgtgcgtggacaa |
26579224 |
T |
 |
| Q |
101 |
ggacttgttgagtaagaggtagcaataccaaattttcaacgcaatcatgtaaagcttgtagatcggttagctttttaccgaacaacgatgaagagttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26579225 |
ggacttgttgagtaagaggtagcaataccaaattttcaacgcaatcatgtaaagcttgtagatcggttagctttttaccgaacaacgatgaagagttgat |
26579324 |
T |
 |
| Q |
201 |
tgcgtcgaaaggctctaaatttgccaagtgttgattgcattgtagaatgagaggatgtggtttcgacggcaagcttttcgagcgaggttggtgatgtgat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26579325 |
tgcgtcgaaaggctctaaatttgccaagtgttgattgcattgtagaatgaggggatgtggtttcgacggcaagcttttcgagcgaggttggtgatgtgat |
26579424 |
T |
 |
| Q |
301 |
gttggactaaaaggaatggtagtactagt |
329 |
Q |
| |
|
||||| |||||||||||| |||||||||| |
|
|
| T |
26579425 |
gttgggctaaaaggaatgatagtactagt |
26579453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University