View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5855_high_19 (Length: 327)
Name: NF5855_high_19
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5855_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 54 - 176
Target Start/End: Original strand, 41015708 - 41015826
Alignment:
| Q |
54 |
aaaggaacctcttaatgtatataaaatggacaaatgtgtccgttattatgaaacccggagggagagtgttcaaaatttaggttaaattcaaatcaaatta |
153 |
Q |
| |
|
||||||| |||||||||||||| |||||| |||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41015708 |
aaaggaatctcttaatgtatatgaaatggtcaaatgtgtcggttattatggaacccggag----agtgttcaaaatttaggttaaattcaaatcaaatta |
41015803 |
T |
|
| Q |
154 |
aacgcaacattataaagtttctc |
176 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41015804 |
aacgcaacattataaagtttctc |
41015826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 235 - 327
Target Start/End: Original strand, 41015823 - 41015913
Alignment:
| Q |
235 |
tctcgtacatacagcattgatagagagatgatggtggttacaaagtcacatattacagtaacatagaatcataggttagccattccaatgagc |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41015823 |
tctcgtacatacagcattgatagagagatgatggtggttacaaagt--catattacaataacatagaatcataggttagccattccaatgagc |
41015913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University