View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5855_high_31 (Length: 230)
Name: NF5855_high_31
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5855_high_31 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 18049789 - 18050012
Alignment:
| Q |
7 |
agtcttagtagtattatagtctagcctgctcaaaactatgaaccggtcaaagcaccccttaagttgacttccttttccttccacgcaataacaccaaacg |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18049789 |
agtcttagtattattatagtctagcctgctcaaaactaagaaccggtcaaagcaccccttaagttgacttccttttccttccacgcaataacaccaaacg |
18049888 |
T |
|
| Q |
107 |
tccttgccttaatgctcaagattagctagatcactttacgtcttcaacattgtcaacattgcaataaattaattaagtgcctaaacttatactctcctta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18049889 |
tccttgccttaatgctcaagattagctagatcactttacgtcttcaacattgtcaacattgcaacaaattaattaagtgcctaaacttatactctcctta |
18049988 |
T |
|
| Q |
207 |
tactccgtatccgtctgtccgacc |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18049989 |
tactccgtatccgtctgtccgacc |
18050012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 178
Target Start/End: Original strand, 18045143 - 18045233
Alignment:
| Q |
88 |
cacgcaataacaccaaacgtccttgccttaatgctcaagattagctagatcactttacgtcttcaacattgtcaacattgcaataaattaa |
178 |
Q |
| |
|
||||||| | |||||||| ||| || ||||| | ||||| | | ||||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
18045143 |
cacgcaacagcaccaaacttccatgtcttaaagatcaagttgaactagatcactttacgtcttcagcatggtcaacattgcaacaaattaa |
18045233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University