View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5855_low_28 (Length: 246)
Name: NF5855_low_28
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5855_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 40404432 - 40404648
Alignment:
| Q |
12 |
acatcatcaaccgtgaagtccaatcgttggaatgcggttaatttccatgcacgagcttcactcgcctttttcaaagacctagctttgaatatcgttacaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40404432 |
acatcatcaaccgtgaagtccaatcgttggaatgcggttaatttccatgcacgagcttcactcgcctttttcaaagacctagctttaaatatcgttacaa |
40404531 |
T |
|
| Q |
112 |
cagcaaatatagcagagcaaacaagcagcccaacaacaagcaaaagcttcacagtagaagagagtggtcctttaacatgaggttgacgaggtccattagc |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404532 |
cagcaaatatagcagagcaaacaagcaacccaacaacaagcaaaagcttcacagtagaagagagtggtcctttaacatgaggttgacgaggtccattagc |
40404631 |
T |
|
| Q |
212 |
aacaccatctttgcaag |
228 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
40404632 |
aacgccatctttgcaag |
40404648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 24 - 172
Target Start/End: Complemental strand, 4978867 - 4978719
Alignment:
| Q |
24 |
gtgaagtccaatcgttggaatgcggttaatttccatgcacgagcttcactcgcctttttcaaagacctagctttgaatatcgttacaacagcaaatatag |
123 |
Q |
| |
|
||||| ||||| |||||||||| || ||||||||||||||||| ||||| ||||| |||||||||| ||| |||| ||| | | ||| |||||| | | |
|
|
| T |
4978867 |
gtgaattccaaacgttggaatgaagtcaatttccatgcacgagcctcactagccttcttcaaagaccgagccttgattattgctgcaatagcaaacacaa |
4978768 |
T |
|
| Q |
124 |
cagagcaaacaagcagcccaacaacaagcaaaagcttcacagtagaaga |
172 |
Q |
| |
|
|| || |||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
4978767 |
tcgaacatgcaagcaacccaataacaagcaacagcttcacagtagaaga |
4978719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University