View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5855_low_34 (Length: 221)
Name: NF5855_low_34
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5855_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 95
Target Start/End: Original strand, 11450106 - 11450187
Alignment:
| Q |
17 |
gaaatgggcttgaatccattgatatttattaactaaggcca---tattaaaactaattttgataattcttaacataattagt |
95 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11450106 |
gaaatgagcttgaatccattgatatttattaactaaggccatattattaaaactaattttgataattcttaacataattagt |
11450187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University