View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5856_high_10 (Length: 224)
Name: NF5856_high_10
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5856_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 47782773 - 47782964
Alignment:
| Q |
15 |
attttcctacatcgacttcatagtttgttaagcatgaaatgcgagatagccttcacaatgaaaagctagtttaatttctaattgggatcatccctgtagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782773 |
attttcctacatcgacttcatagtttgttaagcatgaaatgcgagatagccttcacaatgaaaagctagtttaatttctaattgggatcatccctgtagt |
47782872 |
T |
 |
| Q |
115 |
aatgagatgaattatgttttcgaaatggaagtatataagaactcagcataaaagtaaacaacggaaatggtcagttaatccataataaagaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782873 |
aatgagatgaattatgttttcgaaatggaagtatataagaactcaacataaaagtaaacaacggaaatggtcagttaatccataataaagaa |
47782964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 95 - 141
Target Start/End: Original strand, 39382057 - 39382103
Alignment:
| Q |
95 |
attgggatcatccctgtagtaatgagatgaattatgttttcgaaatg |
141 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
39382057 |
attgggatcatccctgtagtaattggatgaattaagttttcgaaatg |
39382103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University