View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5856_low_6 (Length: 262)
Name: NF5856_low_6
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5856_low_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 52271467 - 52271214
Alignment:
| Q |
15 |
aatctgaagaaggcgaagcagatgatcccacagatgtttacggataaagatgatgcatatgtatcatctgatgaggaaactgaggagaggctagccaaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271467 |
aatctgaagaaggcgaagcagatgatcccgcagatgtttacggataaagatgatgcatatgtatcatctgatgaggaaactgaggagaggctagccaaac |
52271368 |
T |
 |
| Q |
115 |
agtccctctcttatagagttgtgagttcttgcttctcagct------actatagtaaatgtattgctgtcactttgattttggcagaagtttattgcatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271367 |
agtccctctcttatagagttgtgagttcttgcttctcagctactaatactatagtaaatgtattgctgtcactttgattttggcagaagtttattgcatt |
52271268 |
T |
 |
| Q |
209 |
tccatctttgcctgcgctaaggtactcatgtgatgaaatgatgattatttttgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271267 |
tccatctttgcctgcgctaaggtactcatgtgatgaaatgatgattatttttgt |
52271214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University