View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5858-Insertion-7 (Length: 292)
Name: NF5858-Insertion-7
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5858-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 93 - 244
Target Start/End: Complemental strand, 4057329 - 4057176
Alignment:
| Q |
93 |
agaagcaatagagggcagataaatttgctaagaaagcaacaaaatgactcagagaaacaattcaaaactttgaactttttt-aatcactaagagagatta |
191 |
Q |
| |
|
||||| || |||||| |||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4057329 |
agaagtaaaagagggaagataaatttgctaagcaagcaataaaatgacttagagaaacaattcaaaactttgaacttttttaaatcactaagagagatta |
4057230 |
T |
|
| Q |
192 |
tcaattt-attagcgaatcatggcggtttttggtgacctaaggatatacacatt |
244 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4057229 |
tcaatttgtttagcgaatcatggcggtttttggtgacctaaggatatacacatt |
4057176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 4058423 - 4058354
Alignment:
| Q |
8 |
aataagttgtgtgagtttattagaacttgaatgtgtatctcttatatgagagcatagtgttgcgtcttca |
77 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
4058423 |
aataagttgtgtgagtttattagaacttgtatgtgtatctcttatacgagagcatagtgttgcctcttca |
4058354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University