View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5858_high_12 (Length: 230)
Name: NF5858_high_12
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5858_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 6878660 - 6878855
Alignment:
| Q |
18 |
aaggggacggtgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878660 |
aaggggacggtgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtct |
6878759 |
T |
 |
| Q |
118 |
ccggtggcgcatgacacagtccggtggcatggggaaaggcatttggagaagacaagatttgagacaaagcctacggcaatgcttctgcagacattg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878760 |
ccggtggcgcatgacacagtccggtggcatggggaaaggcatttggagaagacaagattcgagacaaagcctacggcaatgcttctgcagacattg |
6878855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University