View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5858_low_11 (Length: 243)
Name: NF5858_low_11
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5858_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 18050136 - 18050187
Alignment:
| Q |
1 |
catttggtatatcactttgtaatccattttgatgtaggaggggtttctagag |
52 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18050136 |
catttggtatatcactttataatccattttgatgtaggaggggtttctagag |
18050187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 162 - 236
Target Start/End: Original strand, 18050292 - 18050366
Alignment:
| Q |
162 |
tggtggattctagaattttattatcataaatttgtcgcttgcaaacttgtccttttcgcttgctaacctatgctt |
236 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||||||||||| ||||| |||||||||||||| || ||||| |
|
|
| T |
18050292 |
tggtggattttagaattttattatcacaagtttgtcgcttgcaaatttgtcattttcgcttgctaatctctgctt |
18050366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 4395190 - 4395139
Alignment:
| Q |
1 |
catttggtatatcactttgtaatccattttgatgtaggaggggtttctagag |
52 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4395190 |
catttggtatatcactttataatccattttgatgtaggaggggtttctagag |
4395139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 162 - 236
Target Start/End: Complemental strand, 4395034 - 4394960
Alignment:
| Q |
162 |
tggtggattctagaattttattatcataaatttgtcgcttgcaaacttgtccttttcgcttgctaacctatgctt |
236 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||||||||||| ||||| |||||||||||||| || ||||| |
|
|
| T |
4395034 |
tggtggattttagaattttattatcacaagtttgtcgcttgcaaatttgtcattttcgcttgctaatctctgctt |
4394960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 23456563 - 23456611
Alignment:
| Q |
163 |
ggtggattctagaattttattatcataaatttgtcgcttgcaaacttgt |
211 |
Q |
| |
|
||||||||| |||| |||||| ||| || |||||||||||||||||||| |
|
|
| T |
23456563 |
ggtggattccagaactttattttcaaaagtttgtcgcttgcaaacttgt |
23456611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University