View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5858_low_6 (Length: 361)
Name: NF5858_low_6
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5858_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 13 - 348
Target Start/End: Original strand, 35203503 - 35203838
Alignment:
| Q |
13 |
aatataccaaaaatggtgggatcccttccagaactctacgtatgcaggagctttaacgataactacaatagtaacggtgctcaaatttctaaatttggca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35203503 |
aatataccaaaaatggtgggatcccttcctgaactctacgtatgcgggagctttaacgataactacaatagtaatggtgctcaaatttctaaatttggca |
35203602 |
T |
 |
| Q |
113 |
tatggtaatttcaaatctcaatttgtttctagatactatatggtggagcttcctctgctccatctgctcaacatcaatttctgcagcttcctagacacca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203603 |
tatggtaatttcaaatctcaatttgtttctagatactatatggtggagcttcctctgctccatctgctcaacatcaatttctgcagcttcctagacacca |
35203702 |
T |
 |
| Q |
213 |
acaaccagatacattgcttgctggtaaagatcaattttctttccatagtcagagccaatatcttacctcgggtgcaatacaccatgtaacacctgatttc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203703 |
acaaccagatacattgcttgctggtaaagatcaattttctttccatagtcagagccaatatcttacctcgggtgcaatacaccatgtaacacctgatttc |
35203802 |
T |
 |
| Q |
313 |
atagtctaaagcctcatatcataacaatctcatact |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203803 |
atagtctaaagcctcatatcataacaatctcatact |
35203838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 829506 - 829461
Alignment:
| Q |
22 |
aaaatggtgggatcccttccagaactctacgtatgcaggagcttta |
67 |
Q |
| |
|
|||||||||||| ||||||| |||| || ||||||||||||||||| |
|
|
| T |
829506 |
aaaatggtgggaccccttcccgaaccctgcgtatgcaggagcttta |
829461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University