View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5859-Insertion-13 (Length: 108)
Name: NF5859-Insertion-13
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5859-Insertion-13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 35639605 - 35639514
Alignment:
| Q |
8 |
aaaaagttatattgttgaagaccagccatgaaagagtggaagaatttgtttgattgatgatgtttgtttgaaaatagggttttaggtatatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35639605 |
aaaaagttatattgttgaagaccagccatgaaagagtggaagaatttgtttgattgatgatgtttgtttgaaaatagggttttaggtatatg |
35639514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 35642333 - 35642299
Alignment:
| Q |
8 |
aaaaagttatattgttgaagaccagccatgaaaga |
42 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
35642333 |
aaaaagttgtattgttgaagaccagccatgaaaga |
35642299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University