View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5859-Insertion-14 (Length: 77)
Name: NF5859-Insertion-14
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5859-Insertion-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 77
Target Start/End: Original strand, 31825469 - 31825538
Alignment:
| Q |
8 |
aacaataacatgttccaactacttagctaaacaataatacacaaaagagcgctacttcttcttctcttct |
77 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31825469 |
aacaataacatgttccaaatacttagctaaacaataatacacaaaagagtgctacttcttcttctcttct |
31825538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University