View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5859-Insertion-9 (Length: 257)
Name: NF5859-Insertion-9
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5859-Insertion-9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 48 - 203
Target Start/End: Complemental strand, 6697302 - 6697147
Alignment:
| Q |
48 |
ggaaccacatgaggttgttcttgagcacaactgcaaatgaaatgatgaatataattgatcttacactcataattgatcagcatatatagtttgaaatcga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6697302 |
ggaaccacatgaggttgttcttgagcacaactgcaaatgaaatgatgaatacaattgatcttacactcataattgatcagcatatatagtttgaaatcga |
6697203 |
T |
 |
| Q |
148 |
tgacatcacaatattgttatatctctaactcaaaatttgatacttgaatgtgtttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6697202 |
tgacatcacaatattgttatatctctaactcaaaatttaatacttgaatgtgtttg |
6697147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 257
Target Start/End: Complemental strand, 6697128 - 6697097
Alignment:
| Q |
226 |
atactagatctaaaatcaaattatcattccta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6697128 |
atactagatctaaaatcaaattatcattccta |
6697097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University