View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5860-Insertion-11 (Length: 161)
Name: NF5860-Insertion-11
Description: NF5860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5860-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 33805818 - 33805675
Alignment:
| Q |
18 |
atgttttcctccctaatctcaatatcttctacaaattcagaaccttcagaagaagattcatcagcatcttctgccttttcattattgaactccatgttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33805818 |
atgttttcctccctaatctcaatatcttctacaaattcagaaccttcagaagaagattcatcagcatcttctgccttttcattattaaactccatgttca |
33805719 |
T |
 |
| Q |
118 |
tctctttgctaaccttcttagtctcaactaccataatggccttc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33805718 |
tctctttgctaaccttcttagtctcaactaccataatggccttc |
33805675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University