View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5860-Insertion-8 (Length: 327)
Name: NF5860-Insertion-8
Description: NF5860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5860-Insertion-8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 9 - 312
Target Start/End: Complemental strand, 15486748 - 15486445
Alignment:
| Q |
9 |
ttcttcagtcaaacatcacactaaagactcttgatctttcaggcaatcctgttggagatgaaggagctaaggtcagtcttaagttttcagatttattaca |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15486748 |
ttcttcagtcaaacatcacactgaagactcttgatctttcaggcaatcctgttggagatgaaggagctaaggtcagtcttaagtgttcagatttattaca |
15486649 |
T |
|
| Q |
109 |
tctcttaatttgggatttggattaattactattccttcttagtatttctctaaatttatctaattgagttgcttcaactacatacccgaaataaaacata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15486648 |
tctcttaatttgggatttggattaattactattccttcttagtatttctctaaatttatctaattgagttgcctcaactacatacccgaaataaaacata |
15486549 |
T |
|
| Q |
209 |
aataatctttagcacatcgactcccctttattctacacgtttgtactaatagtgatggaggacaaaatgagactaatcttatgtgggaattttgtaattt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
15486548 |
aataatctttagcacatcgactcccctttattctacacgtttgtactaatagtgatggaggacaaaatgggactaatcttatgtgggaattttgttattt |
15486449 |
T |
|
| Q |
309 |
catg |
312 |
Q |
| |
|
|||| |
|
|
| T |
15486448 |
catg |
15486445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University