View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5860-Insertion-9 (Length: 224)
Name: NF5860-Insertion-9
Description: NF5860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5860-Insertion-9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 8954981 - 8955196
Alignment:
| Q |
9 |
ccgcccgtgctcaacgtatgactcaagcgtccataacatcaattaataacaaattttattcaattactttcatatgaatacatgcatatnnnnnnntaga |
108 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
8954981 |
ccgcccgtgctcaacgtacgactcaaacgtccataacatcaattaataacaaattttattcaattactttcataggaatacatgcatataaaaaaataga |
8955080 |
T |
 |
| Q |
109 |
atctctcaatcagggatttttgaatgaaatcattacaagggtagaatactcctacaatgatgagatcataaagggaatacggaatcctcatttttacgag |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||| ||| |
|
|
| T |
8955081 |
atctctcaatcaaggatttttgaatgaaatcattacaagggtagaatactcctacaatgataagatcatgaagggaatatggaatcctcatttttatgag |
8955180 |
T |
 |
| Q |
209 |
taatcttttatttata |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8955181 |
taatcttttatttata |
8955196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University