View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5861-Insertion-10 (Length: 184)
Name: NF5861-Insertion-10
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5861-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 7 - 184
Target Start/End: Complemental strand, 21549802 - 21549625
Alignment:
| Q |
7 |
cagcagcgtatatgtatggtaaaatgaaaagatggatatgttgttatgattactaaccataaccatggcggagtgtattagannnnnnnaatgaaacact |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
21549802 |
cagcaacgtatatgtatggtaaaatgaaaagatggatatgttgttatgattactaaccataaccatggcggattgtattagatttttttaatgaaacact |
21549703 |
T |
|
| Q |
107 |
ctttgacaacaggatctttatctttacgctgcaatacatgagtctggaaagttgttagagcaggtcttcctccctttt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21549702 |
ctttgacaacaggatctttatctttacgctgcgatacatgagtctggaaagttgttagagcaggtcttcctccctttt |
21549625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 72
Target Start/End: Complemental strand, 20361987 - 20361929
Alignment:
| Q |
14 |
gtatatgtatggtaaaatgaaaagatggatatgttgttatgattactaaccataaccat |
72 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20361987 |
gtatatgtacggtaaaatgaaaagatgggtatgttgttatgattactaaccataaccat |
20361929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 142 - 177
Target Start/End: Complemental strand, 20361847 - 20361812
Alignment:
| Q |
142 |
acatgagtctggaaagttgttagagcaggtcttcct |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
20361847 |
acatgagtctggaaagttgttagatcaggttttcct |
20361812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University