View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5862-Insertion-6 (Length: 570)
Name: NF5862-Insertion-6
Description: NF5862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5862-Insertion-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 4e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 19 - 127
Target Start/End: Original strand, 24201959 - 24202067
Alignment:
| Q |
19 |
aggagttttgaaattctattttctactgctctagaatcttagagcagtttcacannnnnnncatttccttcttcccaatcataatgcttcgtctggtttt |
118 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24201959 |
aggagttttgaagtttcattttctactgctctagaatcttagagcagtttcacatttttttcatttccttcttcctaatcctaatgcttcgtctggtttt |
24202058 |
T |
|
| Q |
119 |
gttttcttc |
127 |
Q |
| |
|
||||||||| |
|
|
| T |
24202059 |
gttttcttc |
24202067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 29416245 - 29416185
Alignment:
| Q |
129 |
atcttgtcactcctgtttcttcccgcgttttacgaaatttaaccaactattctcctaacgg |
189 |
Q |
| |
|
||||| |||||||||||||||||||||||| || ||||| ||||||| ||||||||||||| |
|
|
| T |
29416245 |
atcttctcactcctgtttcttcccgcgtttcaccaaattcaaccaaccattctcctaacgg |
29416185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 129 - 187
Target Start/End: Complemental strand, 36680717 - 36680659
Alignment:
| Q |
129 |
atcttgtcactcctgtttcttcccgcgttttacgaaatttaaccaactattctcctaac |
187 |
Q |
| |
|
||||| |||||||| ||||||||||||| | |||||||| || |||| ||||||||||| |
|
|
| T |
36680717 |
atcttctcactcctatttcttcccgcgtctcacgaaattcaagcaaccattctcctaac |
36680659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University