View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5864-Insertion-4 (Length: 433)
Name: NF5864-Insertion-4
Description: NF5864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5864-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 9 - 336
Target Start/End: Original strand, 4820207 - 4820534
Alignment:
| Q |
9 |
tcatcgtgatagcacctacagttgttcacatcttttcggttttatttctggcatgttggcttgtaacattattatatggctctctaattgatttcggtgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4820207 |
tcatcgtgatagcacctacagttgttcacatcttttcggttttatttctggcatgttggcttgtaacattattatatgtctctctaattgatttcggtgc |
4820306 |
T |
|
| Q |
109 |
agcgttaataaactgaatagatcataacattgtttcaataatggaaacgcgaatcaaaagttattgtcacaagataaatgatggtacgaatgctaatgag |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4820307 |
agcgttaagaaactgaatagatcataacattgtttcaataatggaaacgcgaatcaaaggttattgtcacaagataaatgatggtacgaatgctaatgag |
4820406 |
T |
|
| Q |
209 |
atctgcaactcaaaaccacttctggccaaataaacaaacaacaatatatcaacgttggtttgcaatttaccttgtcattgttatcattgtttcggggcaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4820407 |
atctgcaactcaaaaccacttctggccaaataaacaaacaacaatatatcaacgttggtttgcaatttaccttgtcattgttatcattgtttcggggcaa |
4820506 |
T |
|
| Q |
309 |
ggtgctttatcttcagttcttttctgct |
336 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
4820507 |
ggtgctttatgttcagttcttttctgct |
4820534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University