View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5864-Insertion-7 (Length: 231)
Name: NF5864-Insertion-7
Description: NF5864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5864-Insertion-7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 148 - 225
Target Start/End: Original strand, 17993339 - 17993416
Alignment:
| Q |
148 |
actgtgaacccattgtctgtgtcatgttactgtggatcattgtctgtcttatgaaaggtatgactctacttctgtatt |
225 |
Q |
| |
|
||||||||||||||||||| | | |||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17993339 |
actgtgaacccattgtctgcgccgtgttactgtgaatcattgtctgtcttatgaaaggtatgactctttttctgtatt |
17993416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 17993159 - 17993207
Alignment:
| Q |
9 |
taaattaatgtggtgttagacctaaccaaatgttcattgattcttaaat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17993159 |
taaattaatgtggtgttagacctaaccaaatgttcattgattcttaaat |
17993207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 137 - 225
Target Start/End: Original strand, 15119066 - 15119155
Alignment:
| Q |
137 |
ggacacgtggga-ctgtgaacccattgtctgtgtcatgttactgtggatcattgtctgtcttatgaaaggtatgactctacttctgtatt |
225 |
Q |
| |
|
|||||||||||| |||||||||| |||| | || |||| || |||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
15119066 |
ggacacgtgggaactgtgaacccgttgtttctgccatgctattgtggatcattgtctgtcttatgaaaggtatggttctgcttctgtatt |
15119155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 225
Target Start/End: Complemental strand, 25631293 - 25631216
Alignment:
| Q |
148 |
actgtgaacccattgtctgtgtcatgttactgtggatcattgtctgtcttatgaaaggtatgactctacttctgtatt |
225 |
Q |
| |
|
||||||||||| |||||| || |||| | |||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
25631293 |
actgtgaacccgttgtctctgccatgcttttgtggatcattgtctgtcttatgaaaggtatggttctgcttctgtatt |
25631216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University