View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5864-Insertion-8 (Length: 120)
Name: NF5864-Insertion-8
Description: NF5864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5864-Insertion-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 9 - 120
Target Start/End: Complemental strand, 2513324 - 2513213
Alignment:
| Q |
9 |
attgtgcatacataaataatttacatggtatacactcaagttcaatctacatgttctttgactcatgaaatttcatgtggtttctcaccctattgatttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2513324 |
attgtgcatacataaataatttacatggtatacactcaagttcaatttacttgttctttgactcatgaaatttcatgtggtttctcaccctattgatttc |
2513225 |
T |
|
| Q |
109 |
ttgcgtgcccta |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2513224 |
ttgcgtgcccta |
2513213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University