View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5865-Insertion-4 (Length: 213)
Name: NF5865-Insertion-4
Description: NF5865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5865-Insertion-4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 9 - 185
Target Start/End: Original strand, 22986255 - 22986427
Alignment:
| Q |
9 |
atcatcaccatttttctggccataatccaccgttataacactgctgcgcgcggttcagccatgtcctttgactggtaggctgaatttgctgccccgacag |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
22986255 |
atcatcaccatttttctggcca----ccaccgttataacactgctgcgcgcggttcaaccatgtcctttgactggtaggatgaatttgctgccccgatag |
22986350 |
T |
 |
| Q |
109 |
ctccctcttcttcagcgtagttgcagcctccaccttcagctgcggttccaccaccattcaggtcatttgcacaggtt |
185 |
Q |
| |
|
||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22986351 |
ctccctcttctgcagcgtgggtgcagcctccaccttcagctgcggttccaccaccatttaggtcatttgcacaggtt |
22986427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University