View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5866-Insertion-11 (Length: 128)

Name: NF5866-Insertion-11
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5866-Insertion-11
NF5866-Insertion-11
[»] chr3 (1 HSPs)
chr3 (13-128)||(9172070-9172185)
[»] chr1 (3 HSPs)
chr1 (14-86)||(9256982-9257054)
chr1 (18-122)||(9466165-9466269)
chr1 (60-125)||(9238409-9238474)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 13 - 128
Target Start/End: Original strand, 9172070 - 9172185
Alignment:
13 cgtctatgaaagctgtgatgcaaatgatgcaaagagatggagacaacttaaaagttccctgcaacccttttggacctacaacttcatctaatacaactac 112  Q
    ||||||||||| |||||||||||||| ||||| ||||||||||||| ||| ||||||| |  ||||||| ||||||||||||||||||||||||||||||    
9172070 cgtctatgaaaactgtgatgcaaatgctgcaaggagatggagacaagttacaagttccttcaaacccttatggacctacaacttcatctaatacaactac 9172169  T
113 tagtattgttgcacca 128  Q
    || |||||||||||||    
9172170 taatattgttgcacca 9172185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 8e-22; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 8e-22
Query Start/End: Original strand, 14 - 86
Target Start/End: Complemental strand, 9257054 - 9256982
Alignment:
14 gtctatgaaagctgtgatgcaaatgatgcaaagagatggagacaacttaaaagttccctgcaacccttttgga 86  Q
    ||||||||||| ||||||||||||| || || ||||||||||||||||||||||| |||||||||||||||||    
9257054 gtctatgaaagatgtgatgcaaatgctgaaaggagatggagacaacttaaaagtttcctgcaacccttttgga 9256982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 9466269 - 9466165
Alignment:
18 atgaaagctgtgatgcaaatgatgcaaagagatggagacaacttaaaagttccctgcaacccttttggacctacaacttcatctaatacaactactagta 117  Q
    |||||| ||||||| |||||| | ||| | ||||||||||| |||||||| ||| |||| |||||||| |||||||||||| ||||| ||||| ||||||    
9466269 atgaaaactgtgatacaaatgctacaaggtgatggagacaagttaaaagtccccagcaatccttttgggcctacaacttcaactaattcaactgctagta 9466170  T
118 ttgtt 122  Q
     ||||    
9466169 ctgtt 9466165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 60 - 125
Target Start/End: Original strand, 9238409 - 9238474
Alignment:
60 ttaaaagttccctgcaacccttttggacctacaacttcatctaatacaactactagtattgttgca 125  Q
    ||||||||||||| ||||||||||||| ||||| ||||| | |||| |||||||| || |||||||    
9238409 ttaaaagttccctccaacccttttggatctacagcttcagcaaataaaactactattaatgttgca 9238474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University