View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866-Insertion-8 (Length: 349)
Name: NF5866-Insertion-8
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866-Insertion-8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 52392767 - 52392532
Alignment:
| Q |
9 |
aaagggtggaattagatttagatagatcattcagatcaagcactaattccatgtcctgtgtttaattttgatgatcccaagttggctacgtgatactgcg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52392767 |
aaagggtggaattagatttagatagatcattcagatcaagcactaattccatgtcctgtgtttaattttgatgatcccaagttggctacgtgatactgcg |
52392668 |
T |
|
| Q |
109 |
atacatacttgctggtaggagcttccatcactggaggttcattaagaaacgcccagttgctcttggtccacctgcactcacccaatgcaaccatatccaa |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52392667 |
atgcatacttgctggtaggagcttccatcactggaggttcattaagaaacgcccagttgctcttggtccacctgcactcacccaatgcaaccatatccaa |
52392568 |
T |
|
| Q |
209 |
attcaatataaagtttatatattccaaattaaaagt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52392567 |
attcaatataaagtttatatattccaaattaaaagt |
52392532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 241 - 349
Target Start/End: Complemental strand, 52392505 - 52392397
Alignment:
| Q |
241 |
aagtagttgaattggaacattgattttttaaaagatggaccgaaattcgaatcaaacaactaagatagtttaccagccatttttcttcatatttttaagc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52392505 |
aagtagttgaattggaacattgattttttaaaagatggaccgaaattcgaatcaaacaactaagatagtttaccagccatttttcttcatatttttaagc |
52392406 |
T |
|
| Q |
341 |
tgctccata |
349 |
Q |
| |
|
||||||||| |
|
|
| T |
52392405 |
tgctccata |
52392397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 112 - 188
Target Start/End: Complemental strand, 7117203 - 7117127
Alignment:
| Q |
112 |
catacttgctggtaggagcttccatcactggaggttcattaagaaacgcccagttgctcttggtccacctgcactca |
188 |
Q |
| |
|
|||||||||||| | ||||||||| ||||| || ||||| ||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
7117203 |
catacttgctggatgcagcttccattactggtggctcattcagaaatgcccagttactcttagtccacctgcactca |
7117127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University