View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_high_54 (Length: 337)
Name: NF5866_high_54
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_high_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 22 - 321
Target Start/End: Original strand, 36104895 - 36105194
Alignment:
| Q |
22 |
gacatcaaacgcagtacaagcttcagttcatcctcaacctctgctcatctctccggtcgatcccttccatttcctcctcctcctccaaccaccaccaaac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36104895 |
gacatcaaacgcagtacaagcttcagttcatcctcaacctccgctcatctctccggtcgatcccttccatttcctcctcctcctccaaccaccaccaaac |
36104994 |
T |
|
| Q |
122 |
atcacgctccttcctccgacccacgctggtcagccattcaccggatccaatccgaatccccttctcgtcgcatcctcccctccgacctccgcttctcccg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36104995 |
atcacgctccttcctccgacccacgctggtcagccattcaccggatccaatccgaatccccttctcgtcgcatcctcccctccgacctccgcttctccca |
36105094 |
T |
|
| Q |
222 |
ccgtctcggctccggcgacatcagctctgtctacctcgctgaacttaatgacgacggcaagattccggcgatgtttgcggcgaaagtgatggataagaag |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36105095 |
ccgtctcggctccggcgacatcagctctgtctacctcgctgaacttaatgacgacggcaagattccggcgatgtttgcggcgaaagtgatggataagaag |
36105194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University