View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_high_68 (Length: 261)
Name: NF5866_high_68
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_high_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 16758127 - 16757891
Alignment:
| Q |
10 |
ataatactcgtatgagttctcctttgatgcattgatgttcagatgactcagtggcaaaccaagttctagatcaatttttggcatactctttcatgaatca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16758127 |
ataatactcgtatgagttctcctttgatgcattgatgttcagatgactcggtggcaaaccaagttctagatcaatttttggcatactcttgcatgaatca |
16758028 |
T |
|
| Q |
110 |
actaactaacctattaccttgtgtcctcatatttcatttagcagagtcgatgcattttctaaattccatcgtcattgtcctcttttctccgtatggttca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
16758027 |
actaactaacctattaccttgtgtcctcatatttcatttagcagagtcgatgtattttctaaattccatcgtcattgtcctcttttctccatattgttca |
16757928 |
T |
|
| Q |
210 |
tgtctcttcatgtacatactttcctccatatttttag |
246 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
16757927 |
tgtctcttcatgaacattctttcctccatatttttag |
16757891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University