View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_high_69 (Length: 260)
Name: NF5866_high_69
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_high_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 44829783 - 44830033
Alignment:
| Q |
1 |
gagattaaaatgttcacatttccccctcaatttatagtggaaagtaagaagaataatcatgtagaaaacataattacacataactatatacaaaatttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829783 |
gagattaaaatgttcacatttccccctcaatttatagtggaaagtaagaagaataatcatgtagaaaacataattacacataactatatacaaaatttca |
44829882 |
T |
 |
| Q |
101 |
aagaattaacaatcaaattgaactcactttaatcgactcagctcgttcattttggatttgctttttcaccaaatgtatcttgttcgtcaaggtttgacga |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829883 |
aagaattaacaaccaaattgaactcactttaatcgactcagctcgttcattttggatttgctttttcaccaaatgtatcttgttcgtcaaggtttgacga |
44829982 |
T |
 |
| Q |
201 |
gtgattgtcgctccccctccatgtttttcctatccatacaataagtattat |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44829983 |
gtgattgtcgctccccctccatgttttgcctatccatacaataagtattat |
44830033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University