View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_high_74 (Length: 252)
Name: NF5866_high_74
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_high_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 28 - 128
Target Start/End: Complemental strand, 26769644 - 26769544
Alignment:
| Q |
28 |
gtgacatattttatccaaaactagagatcgaagacgttttgatttaatagatgctgaaaggaacataatgatctttttaccttttgttgagtagtgctag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26769644 |
gtgacatattttatccaaaactagagatcgaagacgttttgatttaatagatactgaaaggaacataatgatctttttaccttttgttgagtagtgctag |
26769545 |
T |
 |
| Q |
128 |
a |
128 |
Q |
| |
|
| |
|
|
| T |
26769544 |
a |
26769544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 26769378 - 26769311
Alignment:
| Q |
167 |
aatggaagtccgatagaggagtccaaggtgtggaagggactaagacatggtgatcctttgtctctgtt |
234 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26769378 |
aatggaagtgcgatagaggagtccaaggtgtggaagggactaagacatggtgatcctttgtctctgtt |
26769311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University