View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5866_high_74 (Length: 252)

Name: NF5866_high_74
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5866_high_74
NF5866_high_74
[»] chr3 (2 HSPs)
chr3 (28-128)||(26769544-26769644)
chr3 (167-234)||(26769311-26769378)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 28 - 128
Target Start/End: Complemental strand, 26769644 - 26769544
Alignment:
28 gtgacatattttatccaaaactagagatcgaagacgttttgatttaatagatgctgaaaggaacataatgatctttttaccttttgttgagtagtgctag 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
26769644 gtgacatattttatccaaaactagagatcgaagacgttttgatttaatagatactgaaaggaacataatgatctttttaccttttgttgagtagtgctag 26769545  T
128 a 128  Q
    |    
26769544 a 26769544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 26769378 - 26769311
Alignment:
167 aatggaagtccgatagaggagtccaaggtgtggaagggactaagacatggtgatcctttgtctctgtt 234  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26769378 aatggaagtgcgatagaggagtccaaggtgtggaagggactaagacatggtgatcctttgtctctgtt 26769311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University