View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_high_77 (Length: 250)
Name: NF5866_high_77
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_high_77 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 4078214 - 4077977
Alignment:
| Q |
1 |
gcaaagtccatatcctccctagttttttgcagtcgaacaaggcataaatttcatctattatccaatcaatctcacccttgttatgttccaccctcacttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4078214 |
gcaaagtccatatcctccctagttttttggagtcgaacaaggcataaatttcatctattatccaatcaatctcacccttgttatgtgccaccctcacttg |
4078115 |
T |
|
| Q |
101 |
tgtgaatatattctatgtgtcaaccattcctaaatcttcttctccactaatcatcactgctactagatcaacaatattagcctccatagtacatcggtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4078114 |
tgtgaatatattctatgtgtcaaccattcctaaatcttcttctccactaatcatcactgctactagatcaacaatattagcctccatagtacatcggtat |
4078015 |
T |
|
| Q |
201 |
ttttgaggaatttccattatatgaggcataaccattcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4078014 |
ttttgaggaatttccattatatgaggcataaccattcc |
4077977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 4100969 - 4100846
Alignment:
| Q |
1 |
gcaaagtccatatcctccctagttttttgcagtcgaacaaggcataaatttcatctattatccaatcaatctcacccttgttatgttccaccctcacttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4100969 |
gcaaagtccatatcctccctagttttttgcagttgaacaaggcataaatttcatctattatccaatcaatctcacccttgttatgtgccaccctcacttg |
4100870 |
T |
|
| Q |
101 |
tgtgaatatattctatgtgtcaac |
124 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
4100869 |
tgtgaatatattctacgtgtcaac |
4100846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University