View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_high_91 (Length: 232)
Name: NF5866_high_91
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_high_91 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 40470109 - 40470325
Alignment:
| Q |
1 |
tgcaataatagatttttaatagaggttaaaagagaggacaaatagtgaatgagtacttttactgccaccaattttgctttaccttactctagaaaataga |
100 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40470109 |
tgcaataatagatgttgaatagaggttaaaagagaggacaaatagtgaatgactacttttactgccaccaattttgctttaccttactctagaaaatagg |
40470208 |
T |
 |
| Q |
101 |
taagaataggcttgagtcattcattcccaaccattctttgtggnnnnnnnntcatgaccctgaagtcacaaagacttcttttacaaattaatattctcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40470209 |
taagaataggcttgagtcattcattcccaaccattctttgtggaaaaaaaatcatgaccctgaagtcacaaagacttcttttacaaattaatattctcta |
40470308 |
T |
 |
| Q |
201 |
aaccaataagaatttga |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40470309 |
aaccaataagaatttga |
40470325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University