View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_29 (Length: 435)
Name: NF5866_low_29
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_29 |
 | |
|
| [»] scaffold0477 (1 HSPs) |
| | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 3e-64; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 155 - 283
Target Start/End: Original strand, 15037937 - 15038065
Alignment:
| Q |
155 |
ttgggtatggcttcaactattcctccagcctgtcaattagtttaccacaaacatgttatgcacaaatgatcaaattatgtttaaatgattttacaaacga |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15037937 |
ttgggtatggcttcaactattcctccagcctgtcaattagtttaccacaaacatgttatgcacaaatgatcaaattatgtttaaatgattttaaaaacga |
15038036 |
T |
|
| Q |
255 |
aattgtggaatggaatatgggttgaatgg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15038037 |
aattgtggaatggaatatgggttgaatgg |
15038065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 26 - 211
Target Start/End: Complemental strand, 18181498 - 18181302
Alignment:
| Q |
26 |
aacaaaaatggtgttttcattatggtctcacagaacgacgattgcttaaatatatccgtatcgctggaaaagcaaaagttt-aac----------ttact |
114 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||| |||||||||||| | ||||||||||||||||| |||| || ||| ||||| |
|
|
| T |
18181498 |
aacaaaaattgcgttttcattatggtcttacagaacgacaattgcttaaatacgttcgtatcgctggaaaagcgaaaggttcaaccggtcaagttttact |
18181399 |
T |
|
| Q |
115 |
acaattacttgaaatgcgtttggataacatactttattgattgggtatggcttcaactattcctccagcctgtcaattagtttaccacaaacatgtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||| |||| ||||||||||| |||||| ||||||| |
|
|
| T |
18181398 |
acaattacttgaaatgcgtttggataacatactttttcgattgggtatggcttcgactattcctcaagcccgtcaattagttaaccacagacatgtt |
18181302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 339 - 418
Target Start/End: Original strand, 15038121 - 15038200
Alignment:
| Q |
339 |
cgatcattgaatggtttataacgatgccatagagaatgcagtagatatgagccgttgatgatcctgatcccttggaaagc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15038121 |
cgatcattgaatggtttataacgatgccatagagaatgcagtagatatgagtcgttgatgatcctgatcccttggaaagc |
15038200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 72
Target Start/End: Original strand, 15037879 - 15037937
Alignment:
| Q |
14 |
atattgttgaagaacaaaaatggtgttttcattatggtctcacagaacgacgattgctt |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15037879 |
atattgttgaagaacaaaaatggtgttttcattatggtcttacagaacgacgattgctt |
15037937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0477 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: scaffold0477
Description:
Target: scaffold0477; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 29 - 211
Target Start/End: Complemental strand, 10503 - 10309
Alignment:
| Q |
29 |
aaaaatggtgttttcattatggtctcacagaacgacgattgcttaaatatatccgtatcgctggaaaagcaaaagttt-aac-----------ttactac |
116 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||| |||||||||||| | ||||||||||||||||| |||| || ||| ||||||| |
|
|
| T |
10503 |
aaaaattgcgttttcattatggtcttacagaacgacaattgcttaaatacgttcgtatcgctggaaaagcgaaaggttcaaccggtcaagtttttactac |
10404 |
T |
|
| Q |
117 |
aattacttgaaatgcgtttggataacatactttattgattgggtatggcttcaactattcctccagcctgtcaattagtttaccacaaacatgtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||| |||| ||||||||||| |||||| ||||||| |
|
|
| T |
10403 |
aattacttgaaatgcgtttggataacatactttttcgattgggtatggcttcgactattcctcaagcccgtcaattagttaaccacagacatgtt |
10309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 38 - 178
Target Start/End: Complemental strand, 245656 - 245505
Alignment:
| Q |
38 |
gttttcattatggtctcacagaacgacgattgcttaaatatatccgtatcgctggaaaagcaaaa-gtttaac----------ttactacaattacttga |
126 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| |||| |||| | | ||||||||||||||||||| | | ||| ||||||||||||||||| |
|
|
| T |
245656 |
gttttcattatggtctgacagaacgacaattacttagatatgtacatatcgctggaaaagcaaaaaggtcaacaggccaggttttactacaattacttga |
245557 |
T |
|
| Q |
127 |
aatgcgtttggataacatactttattgattgggtatggcttcaactattcct |
178 |
Q |
| |
|
||||||||||||||| || |||| | ||||||||||||||||||| |||||| |
|
|
| T |
245556 |
aatgcgtttggataatatcctttttcgattgggtatggcttcaaccattcct |
245505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 179
Target Start/End: Original strand, 43106457 - 43106502
Alignment:
| Q |
134 |
ttggataacatactttattgattgggtatggcttcaactattcctc |
179 |
Q |
| |
|
||||||||||||| || | |||||||||||||||| |||||||||| |
|
|
| T |
43106457 |
ttggataacataccttttcgattgggtatggcttcgactattcctc |
43106502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University