View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_44 (Length: 365)
Name: NF5866_low_44
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 4 - 328
Target Start/End: Original strand, 34242320 - 34242643
Alignment:
| Q |
4 |
attaatggttattaggtttatagttttatgattttcaaaaatcaaacccaaaattaaggcctttgattctcttttcataagtcattgtctttttccataa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34242320 |
attaatggttattaggtttatagttttatgattttcaaaaatcaaacccaaaattaaggcctttgattctcttttcataagtcattgtctttttccataa |
34242419 |
T |
 |
| Q |
104 |
actaattaattattcttatgtctttgtgcaatttgtcaattaagatatcctttattattcaactgaagtggttgggatgattttgtaagcaagttggatt |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34242420 |
actaattaattattcttatgtctttatgcaatttgtcaattaagatatcctttattattcaactgaagtggttgggatgattttgtaagcaagttggatt |
34242519 |
T |
 |
| Q |
204 |
aattcatgcatggtgtatatgtgtgaattcatttgtgaatttgtgcatgtctttgtctaagactnnnnnnntcattggtgggaccacctaacannnnnnn |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34242520 |
cattcatgcatggtgtatatgtgtgaattcatttgtgaatttgtgcatgtctttgtctaagactaaaaaaatcattggtgggaccacctaaca-tttttt |
34242618 |
T |
 |
| Q |
304 |
gaggttcttggctacatcatagaat |
328 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34242619 |
gaggttcttggctacatcatagaat |
34242643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University