View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_48 (Length: 355)
Name: NF5866_low_48
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 345
Target Start/End: Original strand, 41484884 - 41485210
Alignment:
| Q |
19 |
ccctttagtatatgatcaccgaaggaatgcactttctttctgaaatctatatccaagggaaaatgggtgatccctgacgattttggggaagaggaagaag |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41484884 |
ccctttagtctatgatcaccgaaggaatgcactttctttctgaaatctatatccgagggaaaatgggtgatccctgacgattttggggaagaggaagaag |
41484983 |
T |
 |
| Q |
119 |
gttctgaagaggcagatgtcgaagaggatgcatgcttatcttgcttttagtctcttgtattttggggaaataatgctagaatattttcagccctttcggt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41484984 |
gttctgaagaggcagatgtcgaagaggatgcatgcttatcttgcttttagtctcttgtattttggggaaataatgttagaatattttcagccctttcggt |
41485083 |
T |
 |
| Q |
219 |
tcgtttttaaatatacagtaatctttctcaaatatctttgtgtttaacatcctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaag |
318 |
Q |
| |
|
||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41485084 |
tcgcttttaaatatacagtaatctttctcgaatatctttgtgtttaacatcctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaag |
41485183 |
T |
 |
| Q |
319 |
agtagtgattccatacaatgatgatgt |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41485184 |
agtagtgattccatacaatgatgatgt |
41485210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University