View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_49 (Length: 353)
Name: NF5866_low_49
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 177 - 338
Target Start/End: Original strand, 3902981 - 3903143
Alignment:
| Q |
177 |
ttgtcgttcgatagttatgaacggaacaat-ttagtatttttgggaggccaaaaaagcaagtctccacaaatatttcaagatgtaggttgtcgacatctt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3902981 |
ttgtcgttcgatagttatgaacggaacaatattagtatttttgggaggccaaaaaagcaagtctccacaaatatttcaagatgtaggttgtggacatctt |
3903080 |
T |
 |
| Q |
276 |
caattaagtcccacaaggtttgtaaaagcgatttaggatgatagggttgaggttagaggtgat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3903081 |
caattaagtcccacaaggtttgtaaaagcgatttaggacgatagggttgaggttagaggtgat |
3903143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 3902853 - 3902964
Alignment:
| Q |
18 |
gtgagaatgcagaggtattagttgtagcactatccagcccaaggagggagaccatagaccatagatggacaaaagctcacaaatatgagctttgtttttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
3902853 |
gtgagaatgcagaggtattagttgtagcactatccagcccaaggagggagaccatagaccatagatgaacaaaagctcacaaatatgagctgtgtttttc |
3902952 |
T |
 |
| Q |
118 |
tagttatgctgg |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3902953 |
tagttatgctgg |
3902964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University