View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_50 (Length: 353)
Name: NF5866_low_50
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 15 - 167
Target Start/End: Original strand, 49985123 - 49985276
Alignment:
| Q |
15 |
tataaataggacgcttgcaattttaacggaaaatcaatccttgtattgtatcgcacacgaattcacattcagtcgcactttcatcgctggaatcaacttc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49985123 |
tataaataggacgcttgcaattttaacggaacatcaatccttgtattgtatcgcacacgaattcacattcagtcgcacgttcatcgctggaatcaacttc |
49985222 |
T |
|
| Q |
115 |
accttctttctgaacctgtagtctcactatctctcgaactgaa-ttatcgactg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
49985223 |
accttctttctgaacctgtagtctcactatctctcaaactgaatttatcgactg |
49985276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 251 - 337
Target Start/End: Original strand, 49985359 - 49985445
Alignment:
| Q |
251 |
actttcgttaaaaataacttgttttgaaattggggttttggaaaacggttgggtatgaattatttttgaattagtgtatgagtgatt |
337 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49985359 |
acttttgttaaaaataacttgttttgaaattggggttttggaaaacggttgggtatgaattatttttgaattagtgcatgagtgatt |
49985445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University