View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_91 (Length: 232)
Name: NF5866_low_91
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_91 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 4078487 - 4078375
Alignment:
| Q |
16 |
caaaattagcaaaagatagagcttttaaaaaattagcagattcgctaggcgaataggtcattgcctagcaaatttaacagagaaaacttagtttttcaac |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4078487 |
caaaattagcaaaagatagagtttttaaaaaattagcagattcgctaggcgaataggtcattgcctagcaaatttaacagagaaaacatagtttttcaac |
4078388 |
T |
 |
| Q |
116 |
ttcaatttcattg |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4078387 |
ttcaatttcattg |
4078375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 4101240 - 4101128
Alignment:
| Q |
16 |
caaaattagcaaaagatagagcttttaaaaaattagcagattcgctaggcgaataggtcattgcctagcaaatttaacagagaaaacttagtttttcaac |
115 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4101240 |
caaaattaacaaaagatagagtttttaaaaaattagcagattcgctaggcgaataggtcattgcctagcaaatttaacagagaaaacatagtttttcaac |
4101141 |
T |
 |
| Q |
116 |
ttcaatttcattg |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4101140 |
ttcaatttcattg |
4101128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 4078276 - 4078191
Alignment:
| Q |
129 |
cacaccatccttcacattccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4078276 |
cacaccatccttcacattccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagtt |
4078191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 4101031 - 4100946
Alignment:
| Q |
129 |
cacaccatccttcacattccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4101031 |
cacaccatccttcacattccctcagtttaggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagtt |
4100946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 4502620 - 4502677
Alignment:
| Q |
154 |
tttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctcccta |
211 |
Q |
| |
|
|||||||||||||||| |||||| || ||||| |||||| ||||||||||||||||| |
|
|
| T |
4502620 |
tttgggaggaattccatgaactttaggtacaactgatgcggagtccatatcctcccta |
4502677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 204
Target Start/End: Complemental strand, 19568774 - 19568715
Alignment:
| Q |
145 |
ttccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatc |
204 |
Q |
| |
|
|||| ||| |||| ||||||||||| |||||||||||||| ||||| || |||||||||| |
|
|
| T |
19568774 |
ttccttcactttgagaggaattccatgaacttgagatacagatgatacatagtccatatc |
19568715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 37 - 90
Target Start/End: Complemental strand, 19569053 - 19569000
Alignment:
| Q |
37 |
cttttaaaaaattagcagattcgctaggcgaataggtcattgcctagcaaattt |
90 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||| | |||||| |||||| |
|
|
| T |
19569053 |
cttttcaaaaattagcaaattcgctagtcgaataggtcctcgcctagaaaattt |
19569000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University