View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_95 (Length: 226)
Name: NF5866_low_95
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_95 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 40470568 - 40470380
Alignment:
| Q |
20 |
aggaaggtttagtagagccacacattgttatgcaaagttctgtggattctgaagtacttggagatggctttcgctggaggaaatatgggcagaaggtggt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40470568 |
aggaaggtttagtagagccacacattgttatgcaaagttctgtggattctgaagtccttggagatggctttcgctggaggaaatatgggcagaaggtggt |
40470469 |
T |
 |
| Q |
120 |
gaagggaaatccatatcccaggtttatacttttcttcttcaaagtaacttttaaaacgagttgtttcaagattacttataacgcaaggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40470468 |
gaagggaaatccatatcccaggtttatacttttcttcttcaaagtaacttttaaaatgagttgtttcaagattacttataacgcaaggt |
40470380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 142
Target Start/End: Complemental strand, 26966201 - 26966153
Alignment:
| Q |
94 |
tggaggaaatatgggcagaaggtggtgaagggaaatccatatcccaggt |
142 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||| |||| |||| |
|
|
| T |
26966201 |
tggaggaaatatgggcagaaagtagtaaagggaaatccaaatccaaggt |
26966153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University