View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5866_low_97 (Length: 220)
Name: NF5866_low_97
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5866_low_97 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 32065632 - 32065842
Alignment:
| Q |
10 |
agtgagaagaacaattctttcggaatgagtgtgagaatgagataaagatcattaactgagaatctgttaaaaggaggtttcttcatcttatctgagcttt |
109 |
Q |
| |
|
||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32065632 |
agtgaaaagaaaaattctttcggaatgagtttgagaatgagataaagatcattaactgagaatctgttaaaaggaggtttcttcatcttatctgagcttt |
32065731 |
T |
|
| Q |
110 |
catcaccaacagtgagaatggtgacagagtgtccagcaccaagtagctcttttgcaaagtagaagccaatcacagcatgtccaccactattggtatttat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32065732 |
catcaccaacagtgagaatggtgacagagtgtccagcaccaagtagctcttttgcaaagtagaagccaatcacagcatgtccaccactattggtatttat |
32065831 |
T |
|
| Q |
210 |
gattagcacct |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
32065832 |
gattagcacct |
32065842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University