View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5867_high_4 (Length: 293)
Name: NF5867_high_4
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5867_high_4 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 12 - 293
Target Start/End: Complemental strand, 42937 - 42656
Alignment:
| Q |
12 |
agagattacttaatgatatcaatgaattgaagagtacaatgttttcagcaattgagagcagtgataatctactgtaaattcctttctttaatcaaaagtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42937 |
agagattacttaatgatatcaatgaattgaagagtacaatgttttcagcaattgggagcagtgataatctactgtaaattcctttctttaatcaaaagtt |
42838 |
T |
 |
| Q |
112 |
aattcatagttctgaagtttggtttgtcaactttgccaaatttggtcattaattaagatggaacattaatatttgtaaatgatactgttaaaaacttagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837 |
aattcatagttctgaagtttggtttgtcaactttgccaaatttggtcattaattaagatggaacattaatatttgtaaatgatactgttaaaaacttagc |
42738 |
T |
 |
| Q |
212 |
agtgatcagtctattgtagttttcatgttctgatgaagtagtaagaatggtgtcagagagctagtccttttggttgataaat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42737 |
agtgatcagtctattgtagttttcatgttctgatgaagtagtaagaatggtgtcagagagctagtccttttggttgataaat |
42656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University