View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5867_high_9 (Length: 203)
Name: NF5867_high_9
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5867_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 180
Target Start/End: Complemental strand, 22534080 - 22533916
Alignment:
| Q |
16 |
aagaatattgggaactacgttgtcccacaactggtagtaaggatccttaggaagggtgatggaacggttttccagtaaatgagcaagagggaagtgtaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22534080 |
aagaatattgggaactacgttgtcccacaactggtggtaaggatccttaggaagggtgatggaacggttttccagtaaatgagcaagagggaagtgtaca |
22533981 |
T |
|
| Q |
116 |
aaactgtaatcacaatcatctatccagaattccgttgacaagcgtgggtttcttgcagaccgatt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22533980 |
aaactgtaatcacaatcatctatccagaattccgttgacaattgtgggtttcttgcagaccgatt |
22533916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 16 - 177
Target Start/End: Original strand, 22525786 - 22525947
Alignment:
| Q |
16 |
aagaatattgggaactacgttgtcccacaactggtagtaaggatccttaggaagggtgatggaacggttttccagtaaatgagcaagagggaagtgtaca |
115 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22525786 |
aagaataatgggaactaccttgtcccacaaccggtagtaaggatccttaggaagggtgatggaaaggttttccagtaaatgagcaagagggaagtgtaca |
22525885 |
T |
|
| Q |
116 |
aaactgtaatcacaatcatctatccagaattccgttgacaagcgtgggtttcttgcagaccg |
177 |
Q |
| |
|
||| || |||| ||||||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
22525886 |
aaattggaatcgagatcatctataaggaattccgatgacaagtgtgggtttcttgcagaccg |
22525947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University