View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5867_low_5 (Length: 275)
Name: NF5867_low_5
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5867_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 50532076 - 50532314
Alignment:
| Q |
19 |
taaagggcctgagcccactaggtatggcgattgggaacgcaatggtcgctgctctgatttttgatttattgcttactactttacaataaccaataccata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532076 |
taaagggcctgagcccactaggtatggcgattgggaacgcaatggtcgctgctctgatttttgatttattgcttactactttacaataaccaataccata |
50532175 |
T |
|
| Q |
119 |
gcataataaagttgtaagtcataaattgtgtacgtatttctcattcaaatttttaagaatcactgcgttttctcttggttctttattgcttatatgctta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
50532176 |
acataataaagttgtaagtcataaattgtgtacgtatttctcattcaaatttttaagaatcactgcgtattctcttggttctttat--------tgctta |
50532267 |
T |
|
| Q |
219 |
tatgtatgaaactgaggttgggtgaagttgaacagatcaaccctatg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532268 |
tatgtatgaaactgaggttgggtgaagttgaacagatcaaccctatg |
50532314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University