View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868-Insertion-10 (Length: 263)
Name: NF5868-Insertion-10
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868-Insertion-10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 195406 - 195151
Alignment:
| Q |
8 |
agtttgatcgaagtcaatcgcatgcttttgctcctcatttcgatgcttctcttccttatttcatcgacaaatgattcaatattgcggtgtgaagaaccac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195406 |
agtttgatcgaagtcaatcgcatgcttttgctcctcatttcgatgcttctcttccttatttcatcgacaaatgattcaatattgcggtgtgaagaaccac |
195307 |
T |
|
| Q |
108 |
catctctaatagcagcttccgctgccgccttcaagctgagcacattttgctttatctcctttgccttggttccaacagttgcctccaacaaacacttgtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195306 |
catctctaatagcagcttccgctgccgccttcaagctgagcacattttgctttatctcctttgccttggttccaacagttgcctccaacaaacacttgtt |
195207 |
T |
|
| Q |
208 |
gacctcatctctgtttatcaattcgtttgcagcttcacccttgcacattccaatcc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195206 |
aacctcatctctgtttatcaattcgtttgcagcttcacccttgcacattccaatcc |
195151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University