View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868-Insertion-11 (Length: 202)
Name: NF5868-Insertion-11
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868-Insertion-11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 39032286 - 39032096
Alignment:
| Q |
9 |
tatttcttaagagtcaagcctctacgtgataaataaataagaatatcattggtgaaggaatcctttttccacttgtgttaaacacgtgtatagagatgaa |
108 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39032286 |
tatttcttaagagtcaagcttctacgtgataaataaataagaatatcattggtgaaggaatcctttttccactcgtgttaaacacgtgtatagagatgaa |
39032187 |
T |
 |
| Q |
109 |
ataatgataaggacagcatggaaatgttgtaagaagtgtaggataattggatgaagagaaatgatagaaagagacctatatcttgttaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032186 |
ataatgataaggacagcatggaaatgttgtaagaagtgtaggataattggatgaagagaaatgatagaaagagacctatatcttgttaatt |
39032096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University