View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868-Insertion-16 (Length: 61)
Name: NF5868-Insertion-16
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868-Insertion-16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 50
Target Start/End: Complemental strand, 34901589 - 34901548
Alignment:
| Q |
9 |
attcttagtatcatatttaagagtgtcttagagtccggatct |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34901589 |
attcttagtatcatatttaagagtgtcttagagtccagatct |
34901548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University