View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868-Insertion-3 (Length: 790)
Name: NF5868-Insertion-3
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868-Insertion-3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 9 - 393
Target Start/End: Complemental strand, 38673179 - 38672795
Alignment:
| Q |
9 |
gttatgaccctggatcttagtatatgccagttgagatttgtctattttagtgtaactaaccttgatgtttttgtgttacctatgtaggaagaacaacgtg |
108 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38673179 |
gttatgatcctagatcttagtatatgccagttgaaatttgtctattttagtgtaactaaccttgatgtttttgtgttacctatgtaggaagaacaacgtg |
38673080 |
T |
|
| Q |
109 |
ctcgagatttattttacgccctttgggtgcctgatctctttatggaaagagttcagagcaacggggaatggtccctgttctgccccaatgaagcacctgg |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38673079 |
ctcgagatttattctacgccctttgggtgcctgatctctttatggaaagagttcagagcaacggggaatggtccctgttctgccccaatgaagcacctgg |
38672980 |
T |
|
| Q |
209 |
tttggcagattgttggggtgaagaatatgataagttgtacactcagtatgaaaaagcagtaagtttggtcttgataagccggcttattttgtatatttcc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38672979 |
tttggcagattgttggggtgaagaatatgataagttgtacactcagtatgaaaaagcagtaagtttggtcttgataagccgggttgttttgtatatttcc |
38672880 |
T |
|
| Q |
309 |
ggaaggatgtctcttttactgattactgctttattattttctatcaaatccacagggaaaagcaaaaaagattgttcaaacacag |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38672879 |
ggaaggatgtctcttttactgattactgctttattattttctatcaaatccacagggaaaagcaaaaaagattgttcaagcacag |
38672795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 146; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 2e-76
Query Start/End: Original strand, 94 - 267
Target Start/End: Complemental strand, 2060859 - 2060686
Alignment:
| Q |
94 |
aggaagaacaacgtgctcgagatttattttacgccctttgggtgcctgatctctttatggaaagagttcagagcaacggggaatggtccctgttctgccc |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| | ||||||||||||||||||||||| |
|
|
| T |
2060859 |
aggaagagcaacgtgctcgagatttattttacgccctttgggtgcctgatctctttatggaaagagctctgagcgatggggaatggtccctgttctgccc |
2060760 |
T |
|
| Q |
194 |
caatgaagcacctggtttggcagattgttggggtgaagaatatgataagttgtacactcagtatgaaaaagcag |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
2060759 |
caatgaagcacctggtttggcagattgttggggtgaagaatttgataagctgtacactcagtatgaaaaagcag |
2060686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University