View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868-Insertion-9 (Length: 311)
Name: NF5868-Insertion-9
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868-Insertion-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 36 - 217
Target Start/End: Original strand, 35016148 - 35016329
Alignment:
| Q |
36 |
tgtccaaaatggcttctaattctactcacaatgagtttcatgtgtttatgctaattgctattatggttagctctatggtggctacttgtgctggtagttt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35016148 |
tgtccaaaatggcttctaattctactcacaatgagtttcatgtgtttatgctaattgctataatggttagctctatggtggctacttgtgctggtagttt |
35016247 |
T |
|
| Q |
136 |
ctaccaagactttgatctaacatggggtgataaccgtgctaagatattcaatggtggtcaacttctatcacctccccttgac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
35016248 |
ctaccaagactttgatctaacatggggtgataaccgtgctaagatattcaatggtggtcaacttctatcactttcccttgac |
35016329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 206
Target Start/End: Original strand, 42990652 - 42990725
Alignment:
| Q |
133 |
tttctaccaagactttgatctaacatggggtgataaccgtgctaagatattcaatggtggtcaacttctatcac |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||| |||||||||||| |||||| |||||||| ||||| |||| |
|
|
| T |
42990652 |
tttctaccaagattttgatctaacatggggcgatcaccgtgctaagacattcaacggtggtcagcttctttcac |
42990725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 208 - 277
Target Start/End: Complemental strand, 49237548 - 49237479
Alignment:
| Q |
208 |
tccccttgacttcagagggccttctctaataggggaaaagccttccatttccgtcaaatgacccggcccc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49237548 |
tccccttgacttcagagggccttctctaatagaggaaaagccttccatttccgtgaaatgacccggcccc |
49237479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 138 - 204
Target Start/End: Complemental strand, 38214885 - 38214819
Alignment:
| Q |
138 |
accaagactttgatctaacatggggtgataaccgtgctaagatattcaatggtggtcaacttctatc |
204 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38214885 |
accaagactttgatctaacttggggtgaccaccgtgctaagatattcaatggtggtcaacttctatc |
38214819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 138 - 204
Target Start/End: Complemental strand, 38219106 - 38219040
Alignment:
| Q |
138 |
accaagactttgatctaacatggggtgataaccgtgctaagatattcaatggtggtcaacttctatc |
204 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38219106 |
accaagactttgatctaacttggggtgaccaccgtgctaagatattcaatggtggtcaacttctatc |
38219040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University