View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868_high_13 (Length: 219)
Name: NF5868_high_13
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 33641851 - 33642037
Alignment:
| Q |
17 |
aagaaagtttgaggaaccatttaccgaagaattcttcaaggatcaaacaaatttagagaaaaggaaatccacctttgatacaaagcctcccctagagatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33641851 |
aagaaagtttgaggaaccatttaccgaagaattcttcaaggatcaaacaaatttagagaaaaggaaatccacctttgatacaaagcctcccctagagacc |
33641950 |
T |
|
| Q |
117 |
atgtttccttcaaataattggtgccagcaccttggtattcaggtatgtattgtatatatattgtcaaacttcatacataattccaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33641951 |
atgtttccttcaaataattggtgccaataccttggtattcaggtatgtattgtgtatatattgtcaaacttcatacataattccaat |
33642037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University